Search Result

Results for "

viral RNA

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (17) Apoptosis (1) Bacterial (1) Dengue virus (2) Drug Metabolite (2) Endogenous Metabolite (7) Enterovirus (6) Filovirus (3) Flavivirus (3) HBV (7) HCV (13) HCV Protease (2) Histamine Receptor (2) HIV (2) HSV (1) Influenza Virus (12) Isotope-Labeled Compounds (5) Liposome (1) Orthopoxvirus (1) RSV (3) SARS-CoV (14) Sirtuin (1) STING (1) Topoisomerase (4) TRP Channel (2) Virus Protease (2)
By Research Areas:	Cancer (5) Endocrinology (2) Infection (49) Inflammation/Immunology (5) Neurological Disease (1)

By Targets:

DNA/RNA Synthesis (17)

Apoptosis (1)

Bacterial (1)

Dengue virus (2)

Drug Metabolite (2)

Endogenous Metabolite (7)

Enterovirus (6)

Filovirus (3)

Flavivirus (3)

HBV (7)

HCV (13)

HCV Protease (2)

Histamine Receptor (2)

HIV (2)

HSV (1)

Influenza Virus (12)

Isotope-Labeled Compounds (5)

Liposome (1)

Orthopoxvirus (1)

RSV (3)

SARS-CoV (14)

Sirtuin (1)

STING (1)

Topoisomerase (4)

TRP Channel (2)

Virus Protease (2)

By Research Areas:

Cancer (5)

Endocrinology (2)

Infection (49)

Inflammation/Immunology (5)

Neurological Disease (1)

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

MCE Kits

Natural
Products

Isotope-Labeled Compounds

Targets Recommended: DNA/RNA Synthesis Small Interfering RNA (siRNA)

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-156215

NCI-B16

HCV Infection

NCI-B16 is a small molecule RNA binder and inhibits HCV viral replication .

NCI-B16	HCV	Infection
NCI-B16 is a small molecule RNA binder and inhibits HCV viral replication .

HY-126113

KIN101	Flavivirus Dengue virus Influenza Virus HCV	Infection
KIN101 is a potent **RNA viral inhibitor with IC₅₀s of 2 μM, >5 μM for influenza virus and Dengue virus (DNV), respectively. KIN101, an isoflavone agonist of IRF-3** dependent signaling, induces IRF-3 nuclear translocation. KIN101 has broad-spectrum activity against RNA viruses .

HY-137660

pppApG

Others Infection

pppApG is a starting product of both vRNA (viral RNA) and cRNA (complementary RNA) synthesis. pppApG can be used for influenza virus research .

pppApG	Others	Infection
pppApG is a starting product of both vRNA (viral RNA) and cRNA (complementary RNA) synthesis. pppApG can be used for influenza virus research .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-148780

HBV-IN-29	HBV	Infection
HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .

HY-122587

AVG-233	DNA/RNA Synthesis RSV	Infection
AVG-233 is a potent, orally active RNA dependent RNA polymerase (RdRp) inhibitor. AVG-233 prevents initiation of the viral polymerase complex at the promoter. AVG-233 binding site is present in the L_1-1749 fragment. AVG-233 has nanomolar activity against both RSV strains and clinical RSV isolates (EC₅₀=0.14-0.31 μM). AVG-233 can be used for research of respiratory syncytial virus (RSV) .

HY-14768

Favipiravir Maximum Cited Publications 34 Publications Verification T-705	DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial	Infection
Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-152294

3′-Deoxy-3′-methyluridine	DNA/RNA Synthesis	Infection
3′-Deoxy-3′-methyluridine is a nucleoside derivative, involving in preparation inhibitors of RNA-dependent RNA viral polymerase .

HY-149050

Viral polymerase-IN-1 hydrochloride	Influenza Virus SARS-CoV	Infection
Viral polymerase-IN-1 hydrochloride, a Gemcitabine (HY-17026) derivative, potently inhibits influenza A and B viruses infection with IC₉₀ values of 11.4-15.9 μM. Viral polymerase-IN-1 hydrochloride is active against SARS-CoV-2 infection. Viral polymerase-IN-1 hydrochloride suppresses influenza virus infection by affecting viral RNA replication/transcription in cells .

HY-18649

Galidesivir hydrochloride 5+ Cited Publications BCX4430 hydrochloride; Immucillin-A hydrochloride	DNA/RNA Synthesis SARS-CoV Filovirus	Infection
Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC₅₀s ranging from ~3 to ~68 μM .

HY-18649A

Galidesivir 5+ Cited Publications BCX4430; Immucillin-A	DNA/RNA Synthesis SARS-CoV Filovirus	Infection
Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC₅₀s ranging from ~3 to ~68 μM .

HY-106312A

Enviroxime LY122772	Enterovirus	Infection
Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .

HY-158028

PAN endonuclease-IN-2	Influenza Virus	Infection
PAN endonuclease-IN-2 (compound T-31) is a PA_N endonuclease inhibitor (IC₅₀: 0.15 μM) and antiviral agent with broad-spectrum anti- Influenza activity. PAN is the N-terminal PA subunit of the polymerase-RNA complex and the dependent endonuclease (CEN) active site. PAN initiates RNA replication by promoting cleavage of the RNA strand and allowing the polymerase to begin synthesizing new RNA molecules. PAN endonuclease-IN-2 targets both the influenza HA and RdRp complexes, thereby interfering with viral entry into host cells and viral replication .

HY-139850

GPS491	HIV	Infection
GPS491 (EC₅₀ = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.

HY-155583

RNase L-IN-1	DNA/RNA Synthesis	Infection
RNase L-IN-1 (compound 17a) is an inhibitor of RNase L, or Ribonuclease L. RNase L degrades RNAs to prevent viral replication, and mediates the innate immune responses and inflammation .

HY-155583A

RNase L-IN-1 trihydrochloride	DNA/RNA Synthesis	Infection
RNase L-IN-1 (compound 17a) trihydrochloride is an inhibitor of RNase L or ribonuclease L. RNase L degrades RNA to prevent viral replication and mediates innate immune responses and inflammation .

HY-N0086

N6-Methyladenosine 5 Publications Verification 6-Methyladenosine; N-Methyladenosine	Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-148167

2'-Deoxy-2'-fluoro-l-uridine	DNA/RNA Synthesis Virus Protease	Infection
2'-Deoxy-2'-fluoro-l-uridine is an L-nucleoside compound. 2'-Deoxy-2'-fluoro-l-uridine is a potent, selective viral RNA polymerase inhibitor, thereby inhibiting RNA virus replication .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-144047

HBV-IN-16	HBV DNA/RNA Synthesis	Infection
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .

HY-144045

HBV-IN-14	HBV DNA/RNA Synthesis	Infection
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .

HY-144046

HBV-IN-15	HBV DNA/RNA Synthesis	Infection
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .

HY-145794

ZA3-Ep10

Liposome Others

ZA3-Ep10 is a zwitterionic lipid used in lipid nanoparticles formulation for in vivo RNA delivery and non-viral CRISPR/Cas gene editing.

ZA3-Ep10	Liposome	Others
ZA3-Ep10 is a zwitterionic lipid used in lipid nanoparticles formulation for in vivo RNA delivery and non-viral CRISPR/Cas gene editing.

HY-19743

Triazavirin
Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza .

HY-113761

ASN03576800	Filovirus	Infection
ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .

HY-102077

SAMT-247	HIV	Infection
SAMT-247 is a microbicide that selectively inactivate the viral nucleocapsid protein NCp7, causing zinc ejection and preventing RNA encapsidation. SAMT-247 shows good antiviral activity .

HY-126303

GS-443902 GS-441524 triphosphate; Remdesivir metabolite	DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite	Infection
GS-443902 (GS-441524 triphosphate) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC₅₀s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 is the active triphosphate metabolite of Remdesivir .

HY-N8533

Sodium Camptothecin	DNA/RNA Synthesis	Infection Cancer
Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .

HY-W555382

Pseudane IX 2-Nonylquinolin-4(1H)-one	HCV	Infection
Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-149362

MTase-IN-1	SARS-CoV	Infection
MTase-IN-1 (compound 26) is a potent and selective inhibitor of coronavirus nsp14 N7-methyltransferases, with an IC₅₀ of 0.72 nM. MTase-IN-1 impairs viral RNA translation and immune evasion .

HY-126303C

GS-443902 trisodium 5+ Cited Publications GS-441524 triphosphate trisodium; Remdesivir metabolite trisodium	DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite	Infection
GS-443902 trisodium (GS-441524 triphosphate trisodium) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC₅₀s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 trisodium is the active triphosphate metabolite of Remdesivir (GS-5734) .

HY-10118

Filibuvir 2 Publications Verification	HCV DNA/RNA Synthesis	Infection
Filibuvir is an orally active, selective non-nucleoside inhibitor of the *HCV nonstructural 5B protein (NS5B) RNA-dependent RNA* polymerase (RdRp)*. Filibuvir binds noncovalently in the thumb II allosteric pocket of NS5B. Filibuvir inhibits genotype 1a and 1b replicons with EC₅₀s of 59 nM for both isoforms, respectively . Filibuvir preferentially inhibits elongative RNA* synthesis and potently decreases viral RNA accumulation .

HY-30234A

Clemizole hydrochloride	Histamine Receptor TRP Channel HCV Protease HCV	Inflammation/Immunology Endocrinology Cancer
Clemizole hydrochloride is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole hydrochloride is an inhibitor of TRPC5 channel. The IC₅₀ of Clemizole hydrochloride for RNA binding by NS4B is 24 nM, whereas its EC₅₀ for viral replication is 8 µM.

HY-163147

PAN endonuclease-IN-1	Influenza Virus	Infection
PAN endonuclease-IN-1 (Compound 23) is a potent PAN endonuclease inhibitor, with K_d values of 277 μM, 384 μM and 328 μM for WT, I38T and E23K PA_N endonucleases, respectively. The RNA-dependent RNA polymerase acidic N-terminal (PAN) endonuclease, a critical component of influenza viral replication machinery, is an antiviral target .

HY-30234

Clemizole	Histamine Receptor TRP Channel HCV Protease HCV	Inflammation/Immunology Endocrinology Cancer
Clemizole is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole is an inhibitor of TRPC5 channel. The IC₅₀ of Clemizole for RNA binding by NS4B is 24±1 nM, whereas its EC₅₀ for viral replication is 8 µM.

HY-145994

Obeldesivir ATV006	SARS-CoV	Infection
Obeldesivir (ATV006) is a potent, orally active antiviral agent and ester proagents of GS-441524. Obeldesivir inhibits the replication of SARS-CoV-2 and its variants. Obeldesivir can be used for SARS-CoV-2 research .

HY-W015764

T-1105 1 Publications Verification	Flavivirus	Infection
T-1105, a structural analogue of T-705, is a novel broad-spectrum viral polymerase inhibitor. T-1105 inhibits the polymerases of RNA viruses after being converted to ribonucleoside triphosphate (RTP) metabolite. T-1105 has antiviral activity against various RNA viruses. T-1105 can be formed by nicotinamide mononucleotide adenylyltransferase .

HY-135867

NHC-triphosphate	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV	Infection
NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-109025A

Baloxavir 15+ Cited Publications Baloxavir acid; S-033447	Influenza Virus	Infection
Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity .

HY-135867A

NHC-triphosphate tetrasodium	Endogenous Metabolite Enterovirus HCV Topoisomerase	Infection
NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867F

NHC-diphosphate triammonium 1 Publications Verification	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV	Infection
NHC-diphosphate triammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a diphosphate form . NHC-diphosphate triammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867E

NHC-triphosphate tetraammonium 5 Publications Verification	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV	Infection
NHC-triphosphate tetraammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetraammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-155053

ZIKV-IN-6	Others	Inflammation/Immunology
ZIKV-IN-6 (compound 22) is an inhibitor of Zika virus (ZIKV), with low cytotoxicity (CC₅₀＞50 μM). ZIKV-IN-6 binds to ZIKV RdRp directly and inhibits viral RNA synthesis by ZIKV NS5. ZIKV-IN-6 suppresses the excessive inflammatory response and pyroptosis .

HY-124806

TTP-8307	Enterovirus DNA/RNA Synthesis HCV	Infection
TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC₅₀=1.2 μM) and poliovirus by interfering with the synthesis of **viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP)** .

HY-109025AS

Baloxavir-d5 Baloxavir acid-d₅; S-033447-d₅	Isotope-Labeled Compounds Influenza Virus	Infection
Baloxavir-d₅ is deuterium labeled Baloxavir. Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity[1][2].

HY-B0402S

Amantadine-d15 1-Adamantanamine-d₁₅; 1-Aminoadamantane-d₁₅	Influenza Virus Orthopoxvirus SARS-CoV Apoptosis	Infection Neurological Disease Cancer
Amantadine-d₁₅ is the deuterium labeled Amantadine. Amantadine (1-Adamantanamine) is an antiviral agent with activity against influenza A viruses. Amantadine blocks the proton flow through the M2 ion channel (M2 proton channel of influenza A) and thus prevents the release of viral RNA into the cytoplasm of the infected cells. Amantadine is an antiparkinsonian agent[1][2].

HY-N0086S

N6-Methyladenosine-d3 6-Methyladenosine-d₃; N-Methyladenosine-d₃	Isotope-Labeled Compounds	Infection
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-N0086S2

N6-Methyladenosine-13C4 6-Methyladenosine-¹³C₄; N-Methyladenosine-¹³C₄	Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-N0086S3

N6-Methyladenosine-13C3 6-Methyladenosine-¹³C₃; N-Methyladenosine-¹³C₃	Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

Cat. No.	Product Name

HY-L044

Nucleotide Compound Library

491 compounds

Nucleoside and nucleotide analogues are synthetic, chemically modified compounds that have been developed to mimic their physiological counterparts in order to exploit cellular metabolism and subsequently be incorporated into DNA and RNA to inhibit cellular division and viral replication. In addition to their incorporation into nucleic acids, nucleoside and nucleotide analogues can interact with and inhibit essential enzymes such as human and viral polymerases (that is, DNA-dependent DNA polymerases, RNA-dependent DNA polymerases or RNA-dependent RNA polymerases), kinases, ribonucleotide reductase, DNA methyltransferases, purine and pyrimidine nucleoside phosphorylase and thymidylate synthase. These actions of nucleoside and nucleotide analogues have potential therapeutic benefits — for example, in the inhibition of cancer cell growth, the inhibition of viral replication as well as other indications.

MCE offers a unique collection of 491 nucleotide compounds including nucleotide, nucleoside and their structural analogues. MCE Nucleotide Compound Library is a useful tool to discover anti-cancer and antiviral drugs for high throughput screening (HTS) and high content screening (HCS).

HY-L073

Anti-Hepatitis C Virus Compound Library

283 compounds

Hepatitis C virus (HCV) is a hepatotropic enveloped positive- strand RNA virus (family Flaviviridae) that infects the parenchymal cells of the liver. HCV infection is a significant public health burden. Globally, an estimated 71 million people have chronic hepatitis C virus infection. A significant number of those who are chronically infected will develop cirrhosis or liver cancer. To date, there is no vaccine against HCV, and combination pegylated alpha interferon (pIFN-) and ribavirin, the main standard-of-care treatment for HCV, is effective in only a subset of patients and is associated with a wide spectrum of toxic side effects and complications. More recently, new therapeutic approaches that target essential components of the HCV life cycle have been developed, including direct-acting antiviral (DAA) that specifically block a viral enzyme or functional protein and host-targeted agents (HTA) that block interactions between host proteins and viral components that are essential to the viral life cycle. However, the genetic diversity of HCV viruses and the stage of liver disease (i.e., cirrhosis) are revealing themselves as obstacles for effective, pan-genotypic treatments. There still exists a need for the discovery and development of new HCV inhibitors. In particular, since the future of HCV therapy will likely consist of a cocktail approach using multiple inhibitors that target different steps of infection, new antivirals targeting all steps of the viral infection cycle.

MCE offers a unique collection of 283 compounds with identified and potential anti-HCV activity. MCE Anti- Hepatitis C Virus Compound Library is a useful tool for discovery new anti-HCV drugs and other anti-infection research.

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N0086

N6-Methyladenosine 5 Publications Verification 6-Methyladenosine; N-Methyladenosine	Infection Structural Classification Natural Products Microorganisms Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Influenza Virus Endogenous Metabolite
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-N8533

Sodium Camptothecin	Infection Alkaloids Pyrrole Alkaloids Classification of Application Fields Source classification Quinoline Alkaloids Camptotheca acuminata Decne. Plants Nyssaceae Disease Research Fields	DNA/RNA Synthesis
Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .

HY-W555382

Pseudane IX 2-Nonylquinolin-4(1H)-one	Structural Classification Alkaloids Ketones, Aldehydes, Acids Source classification Ruta graveolens Linn. Rutaceae Quinoline Alkaloids Plants	HCV
Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-135867

NHC-triphosphate	Infection Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV
NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867A

NHC-triphosphate tetrasodium	Structural Classification Natural Products Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite Enterovirus HCV Topoisomerase
NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867F

NHC-diphosphate triammonium 1 Publications Verification	Infection Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV
NHC-diphosphate triammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a diphosphate form . NHC-diphosphate triammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

Cat. No.	Product Name	Chemical Structure

HY-B0402S

Amantadine-d15
Amantadine-d₁₅ is the deuterium labeled Amantadine. Amantadine (1-Adamantanamine) is an antiviral agent with activity against influenza A viruses. Amantadine blocks the proton flow through the M2 ion channel (M2 proton channel of influenza A) and thus prevents the release of viral RNA into the cytoplasm of the infected cells. Amantadine is an antiparkinsonian agent[1][2].

HY-N0086S

N6-Methyladenosine-d3
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-109025AS

Baloxavir-d5
Baloxavir-d₅ is deuterium labeled Baloxavir. Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity[1][2].

HY-N0086S2

N6-Methyladenosine-13C4
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-N0086S3

N6-Methyladenosine-13C3
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

HY-W751835

Baloxavir-d4

15+ Cited Publications

Baloxavir-d₄ (Baloxavir acid-d₄; S-033447-d₄) is the deuterium-labeled Baloxavir (HY-109025A). Baloxavir-d₄ (Baloxavir-d₄ acid), derived from the proagent Baloxavir-d₄ marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir-d₄ inhibits viral RNA transcription and replication and has potently antiviral activity .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

viral RNA

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

MCE Kits

NaturalProducts

Isotope-Labeled Compounds

Natural
Products